[Date Prev][Date Next] [Thread Prev][Thread Next] [Date Index] [Thread Index]

Re: Autopkgtests for pilercr



Nilesh Patra <nilesh@nileshpatra.info> writes:

> Since fetching it directly from a file location or a sort of API doesn't seem the way out, writing a script directly looks not easy.

Programmatic retrieval is very much possible, via ncbi-entrez-direct:

  $ efetch -db nuccore -id CP014688.1 -format fasta | head -n175
  >CP014688.1 Acetobacter persici strain TMW2.1084 plasmid pAC1084_1, complete sequence
  ACGAGGTCGTTTCTGTCGACCCGCTGGCTATATTCAGGCTGGTAGATGTCGGCGTGGTCTGATTATTACC
  [...]

or, with a slightly different defline, ncbi-tools-bin:

  $ idfetch -t5 -s 'gb|CP014688.1' | head -n175
  >gi|1149544201|gb|CP014688.1| Acetobacter persici strain TMW2.1084
  ACGAGGTCGTTTCTGTCGACCCGCTGGCTATATTCAGGCTGGTAGATGTCGGCGTGGTCTGATTATTACC
  [...]

That said, pre-retrieval does have the advantage of letting the tests
work offline.

-- 
Aaron M. Ucko, KB1CJC (amu at alum.mit.edu, ucko at debian.org)
http://www.mit.edu/~amu/ | http://stuff.mit.edu/cgi/finger/?amu@monk.mit.edu


Reply to: